مرحبًا بكم في نادي البايثون الخاص بـRSG-Iraq.
يسعى هذا النادي الى تطوير المهارات البرمجية لدى البيولوجيين والذين يسعون في اكتشاف سلك المعلوماتية الحيوية.
هذا النادي يهتم بالتطوير فقط ولن نتطرق الى كيفية تعلم اللغة من الصفر. ولكن يمكنكم دائمًا طرح أي سؤال أو طلب مساعدة في مجموعة الدردشة الخاصة بـ RSG-Iraq.
نحن في عصر المعلومات، استخراج معلومة من الويب أو المكتبات ليست صعبة كما كانت قبل، فيترك أمر تعلم اللغة من الصفر للباحث نفسه. لا بأس بمشاهدة اليوتيوب في أول طريقك، ولكن لا ننصح الاستمرار بطريقة "الاستماع" للمحاضرات. البرمجة وكتابة الكود تحتاج ممارسة وبحث واستكشاف وتفكير، اليوتيوب ما يوصلك أي مكان.
يسعى هذا النادي الى تطوير المهارات البرمجية لدى البيولوجيين والذين يسعون في اكتشاف سلك المعلوماتية الحيوية.
هذا النادي يهتم بالتطوير فقط ولن نتطرق الى كيفية تعلم اللغة من الصفر. ولكن يمكنكم دائمًا طرح أي سؤال أو طلب مساعدة في مجموعة الدردشة الخاصة بـ RSG-Iraq.
نحن في عصر المعلومات، استخراج معلومة من الويب أو المكتبات ليست صعبة كما كانت قبل، فيترك أمر تعلم اللغة من الصفر للباحث نفسه. لا بأس بمشاهدة اليوتيوب في أول طريقك، ولكن لا ننصح الاستمرار بطريقة "الاستماع" للمحاضرات. البرمجة وكتابة الكود تحتاج ممارسة وبحث واستكشاف وتفكير، اليوتيوب ما يوصلك أي مكان.
ماذا الذي ستحتاجه لكتابة كود بايثون؟
1. محرر editor
برنامج مثل النوت باد ولكن بمميزات اضافية لتسهيل كتابة وتنفيذ الكود
أفضل المحررات التي ننصح بها
vscode, pychram, google colab
2. تنصيب بايثون، موقع التحميل
3. الاستعداد للايرور.
قبل بدءك بأي رحلة تعلم، استعد للخطأ والفشل. إذا ما خطأت بأي كود دتسويه، أنت عالأغلب دتنسخ وتلصق مدتتعلم. فاستعد ورحب بالأخطاء لأنها جزء أساسي من كيرف التعلم.
1. محرر editor
برنامج مثل النوت باد ولكن بمميزات اضافية لتسهيل كتابة وتنفيذ الكود
أفضل المحررات التي ننصح بها
vscode, pychram, google colab
2. تنصيب بايثون، موقع التحميل
3. الاستعداد للايرور.
قبل بدءك بأي رحلة تعلم، استعد للخطأ والفشل. إذا ما خطأت بأي كود دتسويه، أنت عالأغلب دتنسخ وتلصق مدتتعلم. فاستعد ورحب بالأخطاء لأنها جزء أساسي من كيرف التعلم.
نفترض أن الكل حاليا منصب البايثون على جهازه ويعرف شلون يطبع "hello world!"
وأفترض أنكم جاهزين لأول تحدي...🔥
وأفترض أنكم جاهزين لأول تحدي...🔥
#Problem.1
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of a length 21 DNA string (whose alphabet contains the symbols 'A', 'C', 'G', and 'T') is "ATGCTTCAGAAAGGTCTTACG."
Given: A DNA string
Return: Four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in
Sample Dataset:
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
Sample Output:
20 12 17 21
سيتم ارسال الداتا سيت الخاصة بالسؤال، ويتوقع من المشاركين كتابة كود بايثون يطبع أربعة أرقام منفصلة كما في Sample Output.
آخر موعد للتسليم 10/12/2024
الرجاء رفع ملف بامتداد .py من خلال هذا الرابط.
كلما حققت إجابات صحيحة أكثر من خلال المسائل التي سنرسلها اسبوعيًا كلما ستجمع نقاطًا أكثر. سنعرض لوحة المتصدرين كل اسبوع نعرض فيها الفائزين الأوائل. تكرار ظهور الفائزين الأوائل في لائحة المتصدرين كل شهر سيضمن لهم شارة العضو النشط وسيتم التعريف بهم في مدونة الويب الخاصة بالمجتمع.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of a length 21 DNA string (whose alphabet contains the symbols 'A', 'C', 'G', and 'T') is "ATGCTTCAGAAAGGTCTTACG."
Given: A DNA string
s of length at most 1000 nt.Return: Four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in
s.Sample Dataset:
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
Sample Output:
20 12 17 21
سيتم ارسال الداتا سيت الخاصة بالسؤال، ويتوقع من المشاركين كتابة كود بايثون يطبع أربعة أرقام منفصلة كما في Sample Output.
آخر موعد للتسليم 10/12/2024
الرجاء رفع ملف بامتداد .py من خلال هذا الرابط.
كلما حققت إجابات صحيحة أكثر من خلال المسائل التي سنرسلها اسبوعيًا كلما ستجمع نقاطًا أكثر. سنعرض لوحة المتصدرين كل اسبوع نعرض فيها الفائزين الأوائل. تكرار ظهور الفائزين الأوائل في لائحة المتصدرين كل شهر سيضمن لهم شارة العضو النشط وسيتم التعريف بهم في مدونة الويب الخاصة بالمجتمع.
هذا هو الملف الي حتشتغلون عليه. عدد الانبوت ثابت اربعة انتجرات لأنه يمثل عدد القواعد النتيروجينية.
الي عنده مشكلة برفع الحل مالته يكتب بالكروب.
الي عنده مشكلة بفهم المسألة أو كتابة الكود يكتب بـدردشة النادي.
الي عنده مشكلة برفع الحل مالته يكتب بالكروب.
الي عنده مشكلة بفهم المسألة أو كتابة الكود يكتب بـدردشة النادي.
Telegram
RSG-Iraq Group Chat
You’ve been invited to join this group on Telegram.
RSG-Iraq Python Club
#Problem.1 A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains. An example of a length 21 DNA string (whose alphabet contains the symbols…
باقي يومين على اخر موعد للتسليم 🔥
انتهى موعد التسليم للأسبوع الأول 🔥
المتصدرين لهذا الأسبوع:
1- كرار حيدر
2- عبدالله
ناقشوا شلون وصلتوا للحل بالكروب حتى الي ماكدر أو ماعرف يحل يستفاد
اذا تكرر اسمكم بالمتصدرين الأسابيع البقية حتحصلون شارة الاكتف ممبر داخل المجتمع 🎉
المتصدرين لهذا الأسبوع:
1- كرار حيدر
2- عبدالله
ناقشوا شلون وصلتوا للحل بالكروب حتى الي ماكدر أو ماعرف يحل يستفاد
اذا تكرر اسمكم بالمتصدرين الأسابيع البقية حتحصلون شارة الاكتف ممبر داخل المجتمع 🎉
#Problem.2
An RNA string is a string formed from the alphabet containing 'A', 'C', 'G', and 'U'.
Given a DNA string t corresponding to a coding strand, its transcribed RNA string u is formed by replacing all occurrences of 'T' in t with 'U' in u.
Sample Dataset
GATGGAACTTGACTACGTAAATT
Sample Output
GAUGGAACUUGACUACGUAAAUU
ارفع الحل من خلال هذا الرابط.
An RNA string is a string formed from the alphabet containing 'A', 'C', 'G', and 'U'.
Given a DNA string t corresponding to a coding strand, its transcribed RNA string u is formed by replacing all occurrences of 'T' in t with 'U' in u.
Sample Dataset
GATGGAACTTGACTACGTAAATT
Sample Output
GAUGGAACUUGACUACGUAAAUU
ارفع الحل من خلال هذا الرابط.
#Problem.3
In DNA strings, symbols 'A' and 'T' are complements of each other, as are 'C' and 'G'.
The reverse complement of a DNA string s is the string s^c formed by reversing the symbols of s, then taking the complement of each symbol (e.g., the reverse complement of "GTCA" is "TGAC").
Given: A DNA string s of length at most 1000 bp.
Return: The reverse complement s^c
of s.
Sample Dataset:
AAAACCCGGT
Sample Output:
ACCGGGTTTT
Upload your answer here
In DNA strings, symbols 'A' and 'T' are complements of each other, as are 'C' and 'G'.
The reverse complement of a DNA string s is the string s^c formed by reversing the symbols of s, then taking the complement of each symbol (e.g., the reverse complement of "GTCA" is "TGAC").
Given: A DNA string s of length at most 1000 bp.
Return: The reverse complement s^c
of s.
Sample Dataset:
AAAACCCGGT
Sample Output:
ACCGGGTTTT
Upload your answer here
اي أحد عنده مشكلة بفهم المسائل أو كيفية رفع الحل ياريت يدز على الگروب أو يضيف تعليق.
المتصدرين هذا الأسبوع:
سبأ سليم
كرار حيدر
عبدالله
كان حل سبأ سليم الأفضل 🔥
Feel free to explain your answer to others
سبأ سليم
كرار حيدر
عبدالله
كان حل سبأ سليم الأفضل 🔥
Feel free to explain your answer to others
The GC-content of a DNA string is given by the percentage of symbols in the string that are 'C' or 'G'. For example, the GC-content of "AGCTATAG" is 37.5%. Note that the reverse complement of any DNA string has the same GC-content.
DNA strings must be labeled when they are consolidated into a database. A commonly used method of string labeling is called FASTA format. In this format, the string is introduced by a line that begins with '>', followed by some labeling information. Subsequent lines contain the string itself; the first line to begin with '>' indicates the label of the next string.
In Rosalind's implementation, a string in FASTA format will be labeled by the ID "Rosalind_xxxx", where "xxxx" denotes a four-digit code between 0000 and 9999.
Given: At most 10 DNA strings in FASTA format (of length at most 1 kbp each).
Return: The ID of the string having the highest GC-content, followed by the GC-content of that string.
Sample Dataset
>Rosalind_6404
CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC
TCCCACTAATAATTCTGAGG
>Rosalind_5959
CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT
ATATCCATTTGTCAGCAGACACGC
>Rosalind_0808
CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC
TGGGAACCTGCGGGCAGTAGGTGGAAT
Sample Output
Rosalind_0808 60.919540
DNA strings must be labeled when they are consolidated into a database. A commonly used method of string labeling is called FASTA format. In this format, the string is introduced by a line that begins with '>', followed by some labeling information. Subsequent lines contain the string itself; the first line to begin with '>' indicates the label of the next string.
In Rosalind's implementation, a string in FASTA format will be labeled by the ID "Rosalind_xxxx", where "xxxx" denotes a four-digit code between 0000 and 9999.
Given: At most 10 DNA strings in FASTA format (of length at most 1 kbp each).
Return: The ID of the string having the highest GC-content, followed by the GC-content of that string.
Sample Dataset
>Rosalind_6404
CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC
TCCCACTAATAATTCTGAGG
>Rosalind_5959
CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT
ATATCCATTTGTCAGCAGACACGC
>Rosalind_0808
CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC
TGGGAACCTGCGGGCAGTAGGTGGAAT
Sample Output
Rosalind_0808 60.919540
🚀 Join the Bioinformatics Algorithm Design Competition! 🧬💻
Whether you're a student, a researcher, or a coding enthusiast, this is your chance to showcase your Python skills and learn something new!
Key Details
🗓 Registration: Open until 31/01/2025
🗓 Submission Period: 01/02/2025 - 07/02/2025
🏆 Prizes:
1st Place: ISCB membership + Certificate of Achievement
All Participants: Certificate of Participation
Why Participate?
Build hands-on experience in bioinformatics.
Gain recognition in the community.
Network with like-minded individuals.
How to Join
📩 Register via https://lnkd.in/dP2z-aRY or scan the QR code.
Let’s innovate, compete, and have fun! Good luck to all participants! 🌟
Whether you're a student, a researcher, or a coding enthusiast, this is your chance to showcase your Python skills and learn something new!
Key Details
🗓 Registration: Open until 31/01/2025
🗓 Submission Period: 01/02/2025 - 07/02/2025
🏆 Prizes:
1st Place: ISCB membership + Certificate of Achievement
All Participants: Certificate of Participation
Why Participate?
Build hands-on experience in bioinformatics.
Gain recognition in the community.
Network with like-minded individuals.
How to Join
📩 Register via https://lnkd.in/dP2z-aRY or scan the QR code.
Let’s innovate, compete, and have fun! Good luck to all participants! 🌟