tgoop.com/rsgiraqpython/23
Last Update:
The GC-content of a DNA string is given by the percentage of symbols in the string that are 'C' or 'G'. For example, the GC-content of "AGCTATAG" is 37.5%. Note that the reverse complement of any DNA string has the same GC-content.
DNA strings must be labeled when they are consolidated into a database. A commonly used method of string labeling is called FASTA format. In this format, the string is introduced by a line that begins with '>', followed by some labeling information. Subsequent lines contain the string itself; the first line to begin with '>' indicates the label of the next string.
In Rosalind's implementation, a string in FASTA format will be labeled by the ID "Rosalind_xxxx", where "xxxx" denotes a four-digit code between 0000 and 9999.
Given: At most 10 DNA strings in FASTA format (of length at most 1 kbp each).
Return: The ID of the string having the highest GC-content, followed by the GC-content of that string.
Sample Dataset
>Rosalind_6404
CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC
TCCCACTAATAATTCTGAGG
>Rosalind_5959
CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT
ATATCCATTTGTCAGCAGACACGC
>Rosalind_0808
CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC
TGGGAACCTGCGGGCAGTAGGTGGAAT
Sample Output
Rosalind_0808 60.919540
BY RSG-Iraq Python Club
Share with your friend now:
tgoop.com/rsgiraqpython/23