tgoop.com/rsgiraqpython/7
Last Update:
#Problem.1
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of a length 21 DNA string (whose alphabet contains the symbols 'A', 'C', 'G', and 'T') is "ATGCTTCAGAAAGGTCTTACG."
Given: A DNA string s of length at most 1000 nt.
Return: Four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in s.
Sample Dataset:
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
Sample Output:
20 12 17 21
سيتم ارسال الداتا سيت الخاصة بالسؤال، ويتوقع من المشاركين كتابة كود بايثون يطبع أربعة أرقام منفصلة كما في Sample Output.
آخر موعد للتسليم 10/12/2024
الرجاء رفع ملف بامتداد .py من خلال هذا الرابط.
كلما حققت إجابات صحيحة أكثر من خلال المسائل التي سنرسلها اسبوعيًا كلما ستجمع نقاطًا أكثر. سنعرض لوحة المتصدرين كل اسبوع نعرض فيها الفائزين الأوائل. تكرار ظهور الفائزين الأوائل في لائحة المتصدرين كل شهر سيضمن لهم شارة العضو النشط وسيتم التعريف بهم في مدونة الويب الخاصة بالمجتمع.
BY RSG-Iraq Python Club
Share with your friend now:
tgoop.com/rsgiraqpython/7